Danio rerio

Kojic acid (5-hydroxy-2-(hydroxymethyl)-4H-pyran-4-one) is a common contaminant of many food products which are part of humans or animals daily nutrition (sake, soy sauce, cereals, fodder and dairy products). This mycotoxin has demonstrated antibacterial, antifungal, antiparasitic, insecticide, antioxidant and skin whitening effects. In this study, adult zebrafish were divided in 4 groups: Control and 3 kojic acid-treated groups which were exposed to 100 mg/l, 204 mg/l and 284 mg/l kojic acid for 7 days. Histological alterations of the control and kojic acid-treated group were examined and compared, with emphasis on liver, kidney, pancreas, intestine, brain and myocardium. While the Control group had no histological alterations, the kojic acid-exposed zebrafish show hepatocytes hyperhydration/vacuolation, fragmentation of the cell membrane, nuclear karyolysis/pycnosis, a significant shortening of the intestinal villi, myocardiocytes degeneration, a moderatesevere myocardial congestion, an important lipid infiltration of the exocrine pancreas leading to the atrophy of the acini, nephrocyte degeneration and hyalinosis, nuclear hyperhydration, reduction to annulation of the tubular lumens. The histological alterations increase proportionally with the kojic acid dose.

... Differential brain expression of a new β-actin gene from zebrafish (Danio rerio). Alejandro Barrallo 1 ,; Rogelio González-Sarmiento 1,2 ,; María García-Isidoro 1 ,; Pilar Cidad 1 ,; Angel Porteros 3 ,; Raquel E. Rodríguez 1. ... Copyright © 1999-2010 John Wiley & Sons, Inc. ...

The antisense knockdown technology, the morpholino oligomer (MO), has been a staple of investigation into development in the model organism zebrafish (Danio rerio) and others such as the African clawed frog (Xenopus laevis and Xenopus tropicalis) for over 15 years. Despite concerns since their inception over off-target effects, MO studies in which these concerns have been minimised with careful controls as recommended by previous reviews have produced a wealth of phenotypic information regarding various gene knockdowns (morphants). However, concerns have again resurfaced in the last few years, which have gestured especially to the rising volume of data displaying the failure of many genetic knockouts (generated using new technologies such as zinc-finger nucleases (ZFN), clustered regularly-interspaced short palindromic repeats (CRISPR) and transcription activator-like effector nucleases (TALEN)) to phenocopy the knockdown phenotype generated by MO studies. Advocates of such concerns have declared such mutants to be the ‘gold standard’ of research into gene function, and called for non-phenocopying MOs to be discarded as false examples of a loss of function (LoF). In this review we critically reevaluate the arguments used by the advocates of such concerns in the light of the emerging fields of developmental plasticity and epigenetics, in order to both suggest possibilities for the reasons behind the morphant-mutant phenotypic incongruence and justify the continued use of MOs as a useful technology in this field to further probe the mechanisms of this hitherto largely unexplained phenomenon particularly.

CHARLES B. KIMMEL, WILLIAM W. BALLARD, SETH R. KIMMEL, BONNIE ULLMANN, AND THOMAS F. SCHILLING Institute of Neuroscience, University of Oregon, Eugene, Oregon 97403-1254 (CBK, SRK, BU, TFS); Department of Biology, Dartmouth College, Hanover, ...

According to Quantum Perspective Model, this article researches whether there is a link between the square root of two number and the genetic codes. At first, when the digits of the square root of two numbers after the comma are converted from decimal (10) number base system to binary (2) number base system, it corresponds to nucleotide bases. Secondly, the results obtained by this way are expressed as nucleotide bases (A, T, C, G, and U). (A)Adenine, (T)Thymine, (C)Cytosine, (G)Guanine, (U)Uracil. From this point of view, when the first two hundred digits of the square root of two number after the comma were calculated. Thirdly, the search result is similar to DANIO RERIO, and even Timema, after the NCBI (National Biotechnology Information Center) searched this sequence [GGATGACTATTAACGTCCAA]. Fourthly, the genetic codes of Zebra fish have been proven to be very similar to human genetic codes. Lastly, Timema has even been proven to have asexual reproduction. In sum, the relationship between the square root of two in mathematical science and the genetic codes also shed lights on Biochemistry. KEY WORDS: Quantum Perspective Model, Danio Rerio, Binary number base system, the square root of two, Timema.

Background, aim and scope The biocide triclosan (TCS) is commonly used in personal care, acrylic, plastic, and textiles products. TCS has been detected in surface water in several countries, and its ecological impact is largely unknown. In this work, the toxicity of TCS in zebrafish (Danio rerio), embryos and adults was studied. Several lethal and sub-lethal endpoints were analysed in organisms exposed to TCS such as mortality, embryo development and behaviour, hatching, micronuclei and biochemical markers (cholinesterase (ChE), glutathione S-transferase (GST) and lactate dehydrogenase (LDH)). Materials and methods Embryo/larvae assay followed the OECD guideline on Fish Embryo Toxicity Test. Embryos were exposed at nominal concentrations of 0.1, 0.3, 0.5, 0.7 and 0.9 mg/l of TCS for 6 days and were inspected daily with the help of a stereomicroscopy for mortality, developmental parameters (otolith formation, eye and body pigmentation, somite formation, heart beat, tail circulation, detachment of the tail-bud from the yolk sac) and hatching. A similar test was run to obtain larvae for ChE, GST and LDH analysis. The adult test followed the OECD Guideline TG 203 in semi-static conditions. Adult zebrafish of similar length and age were exposed to nominal concentrations of 0.1, 0.2, 0.3, 0.4 and 0.5 mg/l of TCS for 96 h and were inspected daily for mortality and behaviour alterations. A second test was run to obtain organs for biomarkers analysis: Heads, muscles and gills were isolated and snap-frozen in eppendorfs and used for ChE, LDH and GST determinations, respectively. Adult zebrafish testing also comprised a third test for micronucleus analysis in which the nominal concentrations of 0, 0.175 and 0.350 mg/l were used. Peripheral blood was obtained by cardiac puncture and used for the analysis. Results TCS showed acute toxicity for embryo/larvae (96 h LC50 = 0.42 mg/l) and delayed hatching. Moreover, embryo toxicity was evident: Delay on the otolith formation and eye and body pigmentation were found, and malformations were also evident, including spine malformations, pericardial oedema and undersize. Biomarkers levels were affected: ChE and LDH activity were increased in larvae exposed to 0.25 mg/l, and GST activity was increased in larvae exposed to 0.25 and 0.35 mg/l. TCS also demonstrated acute toxicity to adult zebrafish (96 h LC50 = 0.34 mg/l). However, TCS did not change biomarkers levels and did not elicit a micronucleus in adults. Discussions Despite the fact that similar 96 h LC50 values have been found for D. rerio embryos and adults (0.42 and 0.34 mg/l, respectively), the embryo assay was much more informative, showing important effects at several levels, including teratogenic response, hatching delay and alteration of biomarker levels. TCS does not seem to be genotoxic for adult fish or to interfere with biomarkers levels at the concentrations tested. Conclusions TCS has deleterious effects on zebrafish adults and during early stages, (including embryotoxicity, hatching delay and alterations of biomarkers levels). The range of endpoints used on the embryo test allows an integrated analysis that contributes to a better understanding of the toxicity and mode of action of TCS. Recommendations and perspectives Future works should focus on a deeper investigation of TCS modes of action on zebrafish early-life stages. As embryo testing was revealed to be so informative, a refinement of the test could be made, including other endpoints such as different biochemical markers as well as DNA microarrays to assess a gene expression level for the effect of exposure to TCS. In the perspective of risk assessment, these endpoints should be explored in order to assess their usefulness as early warning signs and links should be sought between these short-term tests and effects of long-term exposures as it is observed in more realistic scenarios.

Subcommissural organ (SCO)-spondin is a giant glycoprotein of more than 5000 amino acids found in Vertebrata, expressed in the central nervous system and constitutive of Reissner’s fiber. For the first time, in situ hybridization performed on zebrafish (Danio rerio) embryos shows that the gene encoding this protein is expressed transitionally in the floor plate, the ventral midline of the neural tube, and later in the diencephalic third ventricle roof, the SCO. The modular organization of the protein in Echinodermata (Strongylocentrotus purpuratus), Urochordata (Ciona savignyi and C. intestinalis), and Vertebrata (Teleostei, Amphibia, Aves and Mammalia) is also described. As the thrombospondin type 1 repeat motifs represent an increasingly large part of the protein during Deuterostomia evolution, the duplication mechanisms leading to this complex organization are examined. The functional significance of the particularly well-preserved arrangement of the series of SCO-spondin repeat motifs and thombospondin type 1 repeats is discussed.

Ten (CA)nmicrosatellite simple sequence repeat (SSR) markers, 1, 2, 12, 14, 16, 18, 20, 22, 26, and 29, were used to show high chiasma interference and to determine centromere–marker map distances in the zebrafish (Danio rerio). Of these, SSR 12 exhibited no recombinant tetratypes among 175 half-tetrad embryos, placing this marker within 1 cM of the centromere of Linkage Group XVII. Fractions of heterozygous half-tetrads for the remaining nine markers ranged from 0.64 to 0.89. Of these, six recombinant fractions were more than 0.67 (P< 0.05), indicating strong chiasma interference during female meiosis in the zebrafish. Consistent with previous mapping data, SSRs 2 and 20 of Linkage Group VI were tightly linked. Half-tetrad analysis will allow the mapping of the remaining centromeres and may be useful in the mapping of new genes and mutations in the zebrafish.

Viability of polyploid organisms in lower vertebrates including fish provides an additional tool to investigate genetic mechanisms of neoplastic transformation caused by carcinogens. Here we present data on differential sensitivity of diploid and triploid zebrafish ( Danio rerio) to N-nitrosodimethylamine (NDMA) induced hepatocarcinogenesis. The effect of the carcinogen was studied in 100 diploid and 120 triploid zebrafish. Zebrafish, age 5—6 weeks, were exposed to 50 ppm NDMA for 8 weeks and then were transferred into fresh carcinogen-free water until necropsy. At the necropsy performed 24 weeks after beginning the treatment, cholangiolar tumors (cholangiocarcinomas and cholangiomas) were essentially observed in diploid zebrafish only, while the incidence of hepatocellular tumors (hepatocellular carcinomas and adenomas) was similar in diploid and triploid zebrafish, 7.7% and 9.5%, respectively. By contrast, 36 weeks after beginning the treatment, the incidence of hepatocellular tum...