Microbiology (2006), 152, 519–527 DOI 10.1099/mic.0.28287-0 Comparative analysis of antibiotic resistance gene markers in Mycoplasma genitalium: application to studies of the minimal gene complement Oscar Q. Pich,3 Raul Burgos,3 Raquel Planell, Enrique Querol and Jaume Piñol Institut de Biotecnologia i Biomedicina and Departament de Bioquı́mica i Biologia Molecular, Universitat Autònoma de Barcelona, 08193 Bellaterra, Barcelona, Spain Correspondence Jaume Piñol jaume.pinyol@uab.es Received 22 June 2005 Revised 6 October 2005 Accepted 2 November 2005 Mycoplasma genitalium has been proposed as a suitable model for an in-depth understanding of the biology of a free-living organism. This paper reports that the expression of the aminoglycoside resistance gene aac(69)-aph(20), the only selectable marker hitherto available for M. genitalium genetic studies, correlates with a growth impairment of the resistant strains. In light of this finding, a tetM438 construction based on the tetracycline resistance gene tetM was developed; it can be used efficiently in M. genitalium and confers multiple advantages when compared to aac(69)-aph(20). The use of tetM438 significantly improves transformation efficiency and generates visible colonies faster. Finally, the improvements in the pMTnTetM438 construction made it possible to obtain insertions in genes which have not been previously considered to be dispensable under laboratory growth conditions. INTRODUCTION Mycoplasmas belong to the class Mollicutes, a wide group of micro-organisms closely related to the Gram-positive bacteria. Mycoplasmas have small circular genomes, with Mycoplasma genitalium (517 genes) being the free-living organism with the smallest gene complement so far described (Fraser et al., 1995). They have the fewest metabolic pathways described (Pollack et al., 1997) and also exhibit a very reduced biosynthetic capacity which forces them to obtain almost all metabolites from the external environment. Therefore, mycoplasmas are parasites of a wide range of hosts and usually their culture is fastidious in liquid as well as on solid media. The genetic manipulation of mycoplasmas is hindered by the limited number of genetic tools available. The use of replicative plasmids in mycoplasmas is restricted to Mycoplasma pulmonis (Cordova et al., 2002), Mycoplasma capricolum (Lartigue et al., 2003) and Mycoplasma mycoides (Bergemann et al., 1989; King & Dybvig, 1992). Transposons have become commonplace in mycoplasma genetics. However, there are several mycoplasmas that remain refractory to transformation by transposons. Transposons available for mycoplamas are Tn4001 and Tn916, which were originally isolated from the Gram-positive bacteria Staphylococcus aureus (Lyon et al., 1984) and Enterococcus faecalis Abbreviations: CDA, colony diameter average; Gm, gentamicin; Tc, tetracycline. 3These authors contributed equally to this work. 0002-8287 G 2006 SGM (Franke & Clewell, 1981), respectively. The usefulness of Tn4001 (4?7 kb) was first demonstrated in Mycoplasma pneumoniae (Hedreyda et al., 1993) and was then successfully tested in other Mycoplasma species including Mycoplasma gallisepticum (Cao et al., 1994) and Mycoplasma genitalium (Reddy et al., 1996). In contrast to Tn916 (18 kb), Tn4001 is small enough to be used as a routine cloning vector. However, one of the problems with the use of native transposons is their instability and dynamism once transposed, which makes clear interpretation of the results difficult. This problem was solved by the construction of a minitransposon based on Tn4001, which places the tnp gene outside the inverted repeats (Pour-El et al., 2002). The tetM and the aac(69)-aph(20) genes from Tn916 and Tn4001, respectively, have been used as selectable markers in different Mycoplasma species (Dybvig & Voelker, 1996). The tetM gene confers tetracycline (Tc) resistance upon all tested Mycoplasma species. However, in studies focused on M. genitalium, the aac(69)-aph(20) gene is the only selectable marker used for transformation (Dhandayuthapani et al., 1999, 2001). The aac(69)-aph(20) gene confers resistance to the aminoglycosides gentamicin (Gm), kanamycin and tobramycin. AAC(69)-APH(20) is a unique bifunctional enzyme with two different domains: the N-terminal domain has acetyl-CoA-dependent aminoglycoside acetyltransferase activity, whereas the C-terminal domain exhibits aminoglycoside kinase activity (Culebras & Martinez, 1999). It has been suggested that AAC(69)-APH(20) can also phosphorylate several eukaryotic and prokaryotic protein kinase Downloaded from www.microbiologyresearch.org by IP: 54.196.252.114 On: Mon, 24 Oct 2016 02:37:34 Printed in Great Britain 519 O. Q. Pich and others substrates, modifying in this way signal transduction or regulatory pathways (Daigle et al., 1999). M. genitalium has been proposed as a suitable model to achieve an in-depth understanding of the biology of a freeliving organism (Roberts, 2004). Fulfilling this goal depends on the development of new genetic tools and, in particular, on the identification of new selectable markers for M. genitalium genetic studies. In this work we describe the construction of a modified tetM gene (tetM438) that can be used in M. genitalium. Comparison between the tetM438 and aac(69)-aph(20) genes clearly shows a negative effect of aac(69)-aph(20) on the growth of M. genitalium. Moreover, the use of tetM438 increases dramatically the number of transformants obtained and reduces considerably the time needed for colonies to become visible. Using tetM438 in conjunction with a minitransposon derived from Tn4001 (MTn4001), we have been able to obtain insertions in genes which were previously considered to be necessary for M. genitalium growth in laboratory conditions (Hutchison et al., 1999). in 75 cm2 tissue culture flasks. Attached mycoplasmas were scraped off and passed through a 0?45 mm low protein binding filter (Millipore). The filtered cells were then recultured for 24 h in 40 ml SP-4 medium in 150 cm2 tissue culture flasks. Attached mycoplasmas were washed three times with electroporation buffer (8 mM HEPES pH 7?2, 272 mM sucrose), scraped off and resuspended in this buffer at a concentration of approximately 109 cells ml21. Then 90 ml mycoplasma cell suspension was mixed with 5 mg plasmid DNA previously dissolved in 20 ml electroporation buffer. The mixture was transferred to a 2 mm gapped electroporation Plus BTX cuvette, kept on ice for 15 min and then electroporated (2?5 kV, 129 V) using an electro cell manipulator 600 (BTX). After 15 min on ice, 900 ml SP-4 was added and the cells were incubated at 37 uC for 2 h. Aliquots of 200 ml were spread onto Gm- or Tc-supplemented SP-4 agar plates. Isolated colonies were picked, propagated in 5 ml cultures and stored at 280 uC. Several 20 ml drops from serial dilutions of the electroporated cells were spotted on SP-4 agar plates to determine the number of viable cells. The same procedure was used to determine the number of transformant cells, except that SP-4 agar plates were supplemented with Gm or Tc. Colonies from eight spots on each of two different plates were counted to determine the number of viable or transformant cells. DNA manipulations. General DNA manipulations were performed METHODS Culture conditions, plasmids and primers. Escherichia coli strain XL-1 Blue was used for plasmid amplification. It was grown at 37 uC in 2YT broth or LB agar plates containing 75 mg ampicillin ml21 with X-Gal (40 mg ml21) and IPTG (24 mg ml21) when needed. All plasmids and primers used in this work are summarized in Table 1 and Table 2, respectively. Wild-type M. genitalium strain G37 was grown in SP-4 medium (Tully et al., 1979) at 37 uC under 5 % CO2 in tissue culture flasks (TPP). Gm- and Tc-resistant strains were selected on SP-4 agar plates supplemented with Gm 100 mg ml21 (Invitrogen) or Tc 2 mg ml21 (Roche). We previously determined that growth of strain G37 was completely abolished at Tc concentrations above 0?5 mg ml21. Efforts were made to minimize light exposure when Tc-supplemented SP-4 medium was used. Transformation of M. genitalium. This was performed as des- cribed by Reddy et al. (1996), with a few modifications. Briefly, M. genitalium strain G37 was grown to mid-exponential phase according to Sambrook & Russell (2001). Plasmid DNA was obtained by using the Fast Plasmid Mini Eppendorf Kit. All PCR products were previously cloned into EcoRV-digested pBE and then excised with the corresponding restriction enzyme (Roche). PCR products and digested fragments were purified from agarose gels using the EZNA gel extraction Kit (Omega Bio-tek). Plasmid pBSKII+ was used for the construction of pMTn4001. First, the tnp gene was amplified from pIVT-1 by PCR using primers tnp59 and tnp39, which include Bsi WI and SpeI restriction sites at the 59 and 39 ends of the PCR product, respectively. Then, the 1?3 kb PCR product was digested with Bsi WI/SpeI and included in a ligation mixture containing Acc65I/ApaI-digested pBSKII+ and 50 pmol of both IRO-1 and IRO-2 oligonucleotides. In this way, the annealed oligonucleotides recreate an outer inverted repeat adapter. The construction obtained (pRP1) was digested with NotI and SacI and included in a ligation mixture containing 50 pmol of both IRI-1 and IRI-2 oligonucleotides to reconstitute an inner inverted repeat adapter. One clone with the expected restriction pattern was sequenced to confirm that no mutations were Table 1. Plasmids Plasmid pBE pIVT-1 pAM120 pRP1 pMTn4001 pMTnGm pMTnORFTet pMTnTetM438 pENT438 520 Description Source pBSKII+ with MCS removed and substituted by a single EcoRV site Contains Tn4001T derivative Contains Tn916 pBSKII+ containing tnp gene and IRO from Tn4001 pRP1 containing IRI from Tn4001 pMTn4001 containing the aac(69)-aph(20) marker pMTn4001 containing the tetM coding region pMTn4001 containing the tetM438 marker pUC18 containing the region of the M. genitalium genome (NC_000908) from nt 541621 to nt 545324, which includes the mg438 coding region and flanking regions This study Dybvig et al. (2000) Gawron-Burke & Clewell (1984) This study This study This study This study This study This study Downloaded from www.microbiologyresearch.org by IP: 54.196.252.114 On: Mon, 24 Oct 2016 02:37:34 Microbiology 152 Antibiotic resistance gene markers in M. genitalium Table 2. Primers Bold indicates the restriction sites introduced at the 59 end of selected primers. Italic indicates the 22 nt from the putative mg438 gene promoter region. Underlining indicates the three stop codons present in the inverted repeats to prevent translation of the disrupted genes (Byrne et al., 1989). Primer Sequence (5§–3§) tnp-59 tnp-39 IRO-1 IRO-2 IRI-1 IRI-2 aac-aph-5939 TAGAATet-59 MG438PE ORFTc-59* ORFTc-39* RTMG438-59D RTMG438-39D ORFGm-59d ORFGm-39d RTMG297-59§ RTMG297-39§ RTMG359-59|| RTMG359-39|| Tc upstream Tc downstream *Used DUsed dUsed §Used ||Used to to to to to perform perform perform perform perform CGTACGAATTGTGTAAAAGTAAAAAG ACTAGTCTACTTATCAAAATTGATG CTAGATAAAGTCCGTATAATTGTGTAAAAGGGCC CTTTTACACAATTATACGGACTTTAT GATAAAGTCCGTATAATTGTGTAAAAGC GGCCGCTTTTACACAATTATACGGACTTTATCAGCT GGATTCGCGCATCATTGGATGATGGATTCG GAATTCTAGTATTTAGAATTAATAAAGTATGAAAATTATTAATATTGG CAGTTCTTCCTGAATTTTTTACACC GGATCCATGAAAATTATTAATATTGGAGTT GGATCCCTAAGTTATTTTATTGAACATATA TTGTTGGTGGATCTTGTGGTTATGT CAGCTACAAAACCAGTGTTATCAAT GGATCCATGAATATAGTTGAAAATGAAATATG GGATCCAATCTTTATAAGTCCTTTTATAAATTTC TCCACCCTTAGCAGAACCATC ACAACTACTTTAGCTAAGATAGC TGGGTAAAACTACTTTAGCCAG GCTTTCCATAGATACTTACCATC GGTAGTTTTTCCTGCATCAACATG CGTCGTCCAAATAGTCGGATAG tetM RT-PCR. mg438 RT-PCR. aac(69)-aph(20) RT-PCR. mg297 RT-PCR. mg359 RT-PCR. introduced by these procedures. Most of the initial restriction sites of the pBSKII+ multicloning site (from ApaI to NotI) remain in pMTn4001. The aac(69)-aph(20) gene was amplified by PCR from pIVT-1 by using aac-aph-5939 as a single primer. The resulting 2?5 kb fragment was digested with BamHI, purified and ligated into BamHI-digested pMTn4001, creating plasmid pMTnGm. For the construction of pMTnORFTet, the tetM coding region was PCR amplified from pAM120 by using primers ORFTc-59 and ORFTc-39, which include BamHI sites at the ends. The 2 kb PCR product was cloned into BamHI-digested pMTn4001. Finally, to construct pMTnTetM438 the tetM coding region was amplified from pAM120 using primers TAGAATet-59 and ORFTc-39. The TAGAATet-59 oligonucleotide creates a fusion of the tetM coding region and the 22 bp region located upstream of the mg438 translational start codon. The 2 kb PCR product was cloned into EcoRI/BamHI-digested pMTn4001 to obtain plasmid pMTnTetM438. c.f.u. per plate) was spread to make colony size measurements comparable. Thus, while cells electroporated in the presence of pMTnGm were spread undiluted onto several Gm-supplemented SP-4 agar plates, a 1022 dilution of the cells electroporated in the presence of pMTnTetM438 was spread onto Tc-supplemented SP-4 agar plates. To reduce inter-experiment variability, electroporation of either minitransposon derivative was performed sequentially by using aliquots of the same batch of cells and the same medium stock. Additionally, duplicate electroporations were performed to reduce intra-experimental variability. As Tc is readily inactivated in the presence of light, plates were not returned to the incubator once examined. Thus, the same transformation was spread on different plates and a single plate from each transformation experiment was removed from the incubator for examination at 10, 12, 14 and 16 days after electroporation. Several pictures were taken of each plate by using a LeicaMZFLIII microscope and a LeicaDC500 camera. The diameter of 100 colonies was measured by using the Scion Image processing and analysis program to obtain the colony diameter average (CDA). Assay to compare the growth of MTnGm and MTnTetM438 transformants. To monitor and compare the growth of MTnGm- Assay to determine the effect of Gm or Tc on the colony size of MTnGm or MTnTetM438 transformants. M. genitalium cells were and MTnTetM438-transformed cells, we quantified both colony number and size at different days after electroporation. Because colony size is strongly reduced when plates are crowded, a low number of MTnGm- and MTnTetM438-transformed cells (100–500 electroporated in the presence of pMTnGm or pMTnTetM438 and the resultant transformants were grown in liquid medium supplemented with Gm or Tc respectively. Then, transformants were scraped off, passed through a 0?22 mm filter and plated on SP-4 agar http://mic.sgmjournals.org Downloaded from www.microbiologyresearch.org by IP: 54.196.252.114 On: Mon, 24 Oct 2016 02:37:34 521 O. Q. Pich and others with or without antibiotic. The CDA of each sample was obtained after 14 days of incubation. Wild-type cells were also plated to obtain a reference CDA. Southern blots. Eight MTnTetM438 transformants were selected and cultured in 20 ml Tc-supplemented SP-4 medium. Cells were then scraped off and genomic DNA was isolated by using the EZNA Bacterial DNA Kit (Omega Bio-tek). Genomic DNAs were digested with HindIII and probed by Southern blot hybridization by using the Dig DNA Labelling and Detection Kit (Roche). A 2 kb BamHI fragment from pMTnORFTet containing the tetM coding region was used as a probe. RNA manipulation. Total RNA was isolated from 20 ml cultures using TRI Reagent (Invitrogen), following the recommendations of the manufacturer. For RT-PCR assay, total RNAs were retrotranscribed by using random hexamers and the SuperScript First-Strand Synthesis system (Invitrogen). PCRs were then performed by using the primers listed in Table 2. Primer extension of mg438 was performed by annealing 2 pmol 59-Cy5-labelled MG438PE primer with 5 mg total RNA. First-strand synthesis was carried out as described above. Eight microlitres of the preceding reaction were analysed in an ALF DNA sequencer (Pharmacia Biotech). The product of the standard sequencing reactions, using the same 59-Cy5-labelled primer and pENT438 plasmid as DNA template, was included in the same sequencing gel. Genomic DNA sequencing. Genomic DNA from 30 independent MTnTetM438 transformants was isolated as described above. Sequencing with fluorescent dideoxynucleotides was performed by using the Big Dye 3.0 Terminator Kit (Applied Biosystems) and Tc upstream and Tc downstream primers, following the recommendations of the manufacturer, and analysed in an ABI 3100 Genetic Analyser (Applied Biosystems). RESULTS AND DISCUSSION (a) 2.0 kb (b) 1 2 3 1.5 kb 4 5 6 1 2 3 0.5 kb Fig. 1. Transcriptional analysis by RT-PCR of the aac(69)aph(20), tetM and mg438 genes in M. genitalium. (a) Total RNA was isolated from a Tn4001T transformant culture. Lanes 1 and 4 are the RT-PCR negative controls for aac(69)-aph(20) and tetM, respectively. Lanes 2 and 5 are the RT-PCRs performed for aac(69)-aph(20) and tetM, respectively. Lanes 3 and 6 are the respective PCR positive controls performed with the corresponding genomic DNAs. (b) Total RNA was isolated from a wild-type strain culture. Lanes: 1, mg438RT-PCR negative control; 2, the RT-PCR performed for mg438; 3, the PCR positive control performed with genomic DNA. based on the tetM coding region under the control of the mg438 putative promoter (tetM438) was developed. Determination of the mg438 transcriptional start point To identify the mg438 promoter region, we determined its transcriptional start point by primer extension (Fig. 2). For this purpose, the primer MG438PE, which anneals 200 bp downstream of the mg438 translational start codon, was used. In accordance with previous transcriptional studies performed in M. pneumoniae (Weiner et al., 2000) and M. genitalium (Musatovova et al., 2003), heterogeneous transcriptional start points were observed. Bases at the mRNA 59 end were A, A, T and A, which were located at 3, 5, 6 and tetM expression analysis in M. genitalium Since the usefulness of the tetM marker has been demonstrated for several mycoplasma species, we assayed the functionality of this gene in M. genitalium. For this purpose, several Tn4001T tranformants were obtained by electroporation in the presence of pIVT-1. This plasmid bears both the aac(69)-aph(20) and the tetM markers (Dybvig et al., 2000). Transformants were selected in the presence of Gm. The resulting Tn4001T transformants were then spread onto SP-4 agar plates supplemented with different concentrations of Tc; no growth was observed even at the lowest Tc concentration. To test whether the absence of Tc resistance was due to a defect in transcription of the tetM, total RNA from several Tn4001T transformants was isolated and RTPCR assays were performed (Fig. 1a). As a RT-PCR positive control we used a 0?5 kb internal fragment from the mg438 (Fig. 1b), a gene of constitutive expression recently characterized in our laboratory (data not shown). As expected, amplification of the aac(69)-aph(20) cDNA (1?5 kb) was clearly detected. However, no amplification was observed for the tetM cDNA (2 kb), suggesting the absence (or a very low level) of tetM transcription in M. genitalium. To further assess the functionality of tetM in M. genitalium, a construct 522 Fig. 2. Determination of the mg438 transcriptional start points. (a) Standard ALF output corresponding to the sequencing reaction. The sequence shown is the reverse and complementary to the mg438 coding sequence. (b) Chromatogram obtained with the primer extension sample. The two profiles are aligned according to their respective running time. The two putative ”10 regions found are boxed and the translational start codon is underlined. Downloaded from www.microbiologyresearch.org by IP: 54.196.252.114 On: Mon, 24 Oct 2016 02:37:34 Microbiology 152 Antibiotic resistance gene markers in M. genitalium 7 bp upstream from the translational start codon, respectively. Analysis of the region located immediately upstream of the determined transcriptional start points allowed us to identify two putative 210 boxes: TAGTAT and TAGAAT. These 210 boxes are in agreement with the consensus previously described for M. pneumoniae (Weiner et al., 2000). Neither a 235 box nor a canonical RBS could be identified. The lack of a 235 box seems a major feature of mycoplasma promoters (Weiner et al., 2000). Transcription of genes lacking a 235 box has been reported in other bacteria (Sabelnikov et al., 1995). However, these genes have an extended 210 region that can not be found in the region immediately upstream of the mg438 coding region. The presence in M. genitalium of regulatory elements other than 210 boxes remains to be investigated. Construction and functionality of the tetM438 marker in M. genitalium To avoid the genomic instability of Tn4001, we constructed a minitransposon named pMTn4001 (Fig. 3) with a structure very similar to that described by Pour-El et al. (2002). First, we developed a pMTn4001 derivative (pMTnGm) harbouring the aac(69)-aph(20) marker to test the functionality of MTn4001. A second construction (pMTnTetM438), harbouring the tetM438 marker, was also developed. The tetM438 marker is a fusion between the 22 bp region located immediately upstream of the mg438 translational start codon (including the two putative promoters identified) and the tetM coding region. A third construction (pMTnORFTet) based on pMTn4001 harbouring only the tetM coding region was designed to exclude the presence in pMTn4001 of any sequence able to promote transcription of the tetM coding region in M. genitalium. Initial electroporation studies were performed using the three plasmids described above. Transformation efficiencies obtained with pMTnGm and pMTn TetM438 were 561025 and 161023 per viable cell, respectively. As expected, no transformants were obtained when M. genitalium cells were electroporated in the presence of pMTnORFTet. This result confirms that the 22 bp selected region promotes transcription of the tetM438 marker in the MTnTetM438 minitransposon and also the effective translation of the resulting transcript. Thus, this result suggests the presence in this 22 bp region of a RBS different from the canonical one complementary to 16S RNA or alternatively the possibility that mycoplasma ribosomes could initiate translation through a 59 mRNA end in a way similar to eukaryotes, as has been already proposed (Weiner et al., 2000). In addition to the surprisingly higher transformation efficiency of MTnTetM438, colonies derived from this minitransposon were also noticeably larger than those derived from MTnGm. To monitor these differences, a new set of electroporation experiments was devised to carefully quantify both colony number and size at different days after electroporation. The transformation efficiency obtained for each plasmid in such a set of experiments is shown in Table 3. The earliest colonies derived from MTnTetM438 transformants were observed 10 days after plating, while no colonies derived from MTnGm transformants were detected until day 12 (Fig. 4). The number of MTnTetM438 transformants obtained at days 12, 14 and 16 was 50-, 35- and 25fold higher, respectively, than for MTnGm transformants. Fig. 3. Schematic representation of plasmid pMTn4001, showing the multicloning site with the available restriction enzyme sites. The plasmid skeleton is based on the pBSKII+ (bla, b-lactamase; f1(+) ori, single-stranded replication origin; ColE1 ori, vegetative replication origin; tnp, transposase from Tn4001). The boxes show the marker genes cloned in the multicloning site to obtain pMTnGm, pMTnTetM438 and pMTnORFTet respectively. http://mic.sgmjournals.org Downloaded from www.microbiologyresearch.org by IP: 54.196.252.114 On: Mon, 24 Oct 2016 02:37:34 523 O. Q. Pich and others Table 3. Transformation efficiencies obtained for pMTnTetM438 and pMTnGm Values represent the mean of multiple platings (see Methods) of one representative transformation assay. Assay 1 2 3 4 Plasmid Viable cells (c.f.u.) Transformation efficiency* pMTnTetM438 pMTnTetM438 pMTnGm pMTnGm 9?756107 1?056108 9?756107 1?056108 1?4861023 1?0761023 4?0761025 5?1761025 *Transformants per viable cell. This result confirms that the number of transformants obtained with pMTnTetM438 is significantly higher than that obtained with pMTnGm. The average diameter of colonies derived from each minitransposon at different days after electroporation was determined. The CDA of MTnTetM438 transformants was always higher than that of MTnGm transformants and increased from day 10 to day 16 (Fig. 4). The CDA of MTnGm transformants also clearly increased between days 12 and 16 (Fig. 4). These results show that although the aac(69)-aph(20) gene can be used as an effective selectable marker, undesired effects are also evident on the growth of MTnGm-transformed M. genitalium cells. The slower growth of MTnGm transformants could possibly be due to a residual negative effect of Gm on mycoplasma cell growth. However, when MTnGm transformants were plated without antibiotic, the CDA was as low as that obtained when Gm was present (Table 4), and the CDA of MTnTetM438 transformants was very similar to that exhibited by the wild-type colonies. These data suggest that the negative effects described above do not result from an inefficient Gm inactivation by AAC(69)-APH(20) but are a direct consequence of aac(69)-aph(20) expression in M. genitalium. These results also show that the use of tetM438 marker has no detrimental effect on growth of M. genitalium. Day 10 524 Day 12 Day 14 Table 4. CDA of wild-type strain and MTnTetM438 or MTnGm transformants CDAs were obtained after 14 days incubation in presence or absence of antibiotic. Values are means±SE of diameters of 100 colonies from two separate experiments. CDA (mm) MTnGm MTnTetM438 Wild-type With antibiotic 0?139±0?006 0?367±0?022 NA Without antibiotic 0?148±0?007 0?380±0?028 0?393±0?045 Aminoglycoside antibiotics such as Gm are readily inactivated by AAC(69)-APH(20) phosphorylation (Boehr et al., 2004). It has been reported that aminoglycoside phosphotransferase enzymes are also serine protein kinases (Daigle et al., 1999). Since there is evidence of protein modification by phosphorylation in mycoplasmas (Dirksen et al., 1994; Platt et al., 1988), we hypothesize that AAC(69)APH(20) may phosphorylate some M. genitalium proteins, probably thereby modifying the intracellular signalling. The relationship between the possible phosphorylation of mycoplasma proteins by AAC(69)-APH(20) and the reduction of colony size remains to be investigated. However, the negative effect of aac(69)-aph(20) gene expression has to be Day 16 Fig. 4. Colonies derived from MTnTetM438 (top row) or MTnGm transformants (bottom row) after 10–16 days of growth. Bar, 1 mm. Downloaded from www.microbiologyresearch.org by IP: 54.196.252.114 On: Mon, 24 Oct 2016 02:37:34 Microbiology 152 Antibiotic resistance gene markers in M. genitalium considered when designing gene knock-out experiments by either transposition or homologous recombination. Random insertion and stability of MTnTetM438 in the M. genitalium chromosome Genomic DNA isolated from eight independent clones selected from the MTnTetM438 transformants obtained was analysed by Southern blotting (data not shown). As expected, the presence of a single band of different size in each clone showed that MTnTetM438 is randomly inserted in the M. genitalium genome. Since no additional band was Table 5. Transposon insertion sites of 30 randomly selected MTnTetM438 transformants Clone no. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Insertion site Coding region* Intergenic region mg032-ND mg358-DD Annotated function Hypothetical protein RuvA detected, we conclude that MTnTetM438 inserts as a single copy and remains stable once transposed. We also addressed the question of whether insertions in genomic locations not previously described when using aac(69)-aph(20) could be obtained with pMTnTetM438. We determined the transposon insertion site of 30 randomly selected MTnTetM438 transformants (Table 5). We found 28 different transposon insertion sites and two transposon insertions in the same location of the mg269 and mg281 coding regions. Four transposon insertions located in the intergenic regions were in sequences belonging to a family of repetitive DNA elements known as MgPa islands (Peterson et al., 1995). Surprisingly, transposon insertions were detected in two coding regions, mg298 and mg358, in which no transposon insertions were previously reported in the global transposon mutagenesis analysis (Hutchison et al., 1999). Moreover, both transposon insertions are expected to disrupt the gene function (Fig. 5a, b). The mg298 gene encodes P115, a protein with unknown function, and the mg358 gene is currently annotated as ruvA, which is involved in the resolution of Holliday intermediates. The ruvA gene has been previously shown to be dispensable in MgPa (mgp-r7) mg269-D Hypothetical protein mg288m-mg289 mg357-mg358 mg294-D mg385-D Hypothetical protein Hypothetical protein mg041-mg042 mg317-D Hmw3 homologue mg061-mg062 mg199-mg200 mg272-mg273 mg269-D mg278-D mg285-D Hypothetical protein SpoT Hypothetical protein MgPa (mgp-r2) mg438-D Hypothetical protein mg381-mg382 mg226-D mg281-ND mg298-DD Hypothetical protein Hypothetical protein P115 protein MgPa (mgp-r2) mg191-D mg110-D mg363.1-ND MgpB Hypothetical protein RpsT mg024-mg025 mg281-ND mg200-ND Hypothetical protein DnaJ-like protein MgPa (mgp-r4) *D, disruptive insertion; ND, non-disruptive insertion. Only insertion points within the 59-most 80 % of the gene but downstream of nt 9 of the protein-coding region were considered to be disruptive of the gene function (Hutchison et al., 1999). DNo transposon insertions were previously reported for these coding regions in the global transposon mutagenesis analysis. http://mic.sgmjournals.org Fig. 5. (a, b) Schematic representation showing the precise insertion points of MTnTetM438 in the mg298 (a) and mg358 (b) genes. Both transposon insertions are centred in the target gene and are expected to disrupt the gene function. (c) Transcriptional analysis by RT-PCR of the mg297 and mg359 genes in the MTnTetM438 transformant clones 2 and 22, respectively. Total RNA was isolated from cultures of these clones and the wild-type strain. Lanes 2 and 4 correspond to the mg359 RT-PCR products obtained from total RNA isolated from the wild-type and clone 2, respectively. Lanes 6 and 8 are the mg297 RT-PCR products obtained from total RNA isolated from the wild-type and clone 22, respectively. Lanes 1, 3, 5 and 7 correspond to the respective RT-PCR negative controls. Downloaded from www.microbiologyresearch.org by IP: 54.196.252.114 On: Mon, 24 Oct 2016 02:37:34 525 O. Q. Pich and others E. coli (Sharples et al., 1990). No transcriptional defects derived from the transposon insertions were detected by RT-PCR in the downstream genes mg297 and mg359 (Fig. 5c), which have also been considered as essential. However, disruptive insertions in the mg298 and mg358 coding regions show that M. genitalium genes which have not been previously considered as dispensable under laboratory growth conditions could be knocked out by our pMTnTetM438 construction; thus the list of non-essential M. genitalium genes could be longer than previously described. Dirksen, L. B., Krebes, K. A. & Krause, D. C. (1994). Phosphorylation of cytadherence-accessory proteins in Mycoplasma pneumoniae. J Bacteriol 176, 7499–7505. Dybvig, K. & Voelker, L. L. (1996). Molecular biology of mycoplasmas. Annu Rev Microbiol 50, 25–57. Dybvig, K., French, C. T. & Voelker, L. L. (2000). Construction and use of derivatives of transposon Tn4001 that function in Mycoplasma pulmonis and Mycoplasma arthritidis. J Bacteriol 182, 4343–4347. Franke, A. E. & Clewell, D. B. (1981). Evidence for a chromosome- borne resistance transposon (Tn916) in Streptococcus faecalis that is capable of "conjugal" transfer in the absence of a conjugative plasmid. J Bacteriol 145, 494–502. Fraser, C. M., Gocayne, J. D., White, O. & 26 other authors (1995). ACKNOWLEDGEMENTS The minimal gene complement of Mycoplasma genitalium. Science 270, 397–403. This work was supported by grant BFU2004-06377-C02-01 to E. Q. R. B. acknowledges an FPU predoctoral fellowship from the Ministerio de Educación y Ciencia. O. Q. and R. P. acknowledge a predoctoral fellowship from CeRBa (Centre de Referència en Biotecnologia). Plasmids pIVT-1 and pAM120 were the kind gifts of Dr K. Dybvig and Dr D. B. Clewell, respectively. We thank Dra Oxana Musatovova (UTHSCSA) for her valuable advice on performing primer extension and Joan Ruiz (UAB) for performing primer extension ALF analysis. We also thank Anna Barceló (Servei de Seqüenciació UAB) for DNA sequencing. Gawron-Burke, C. & Clewell, D. B. (1984). Regeneration of insertionally inactivated streptococcal DNA fragments after excision of transposon Tn916 in Escherichia coli: strategy for targeting and cloning of genes from gram-positive bacteria. J Bacteriol 159, 214–221. Hedreyda, C. T., Lee, K. K. & Krause, D. C. (1993). Transformation of Mycoplasma pneumoniae with Tn4001 by electroporation. Plasmid 30, 170–175. Hutchison, C. A., Peterson, S. N., Gill, S. R., Cline, R. T., White, O., Fraser, C. M., Smith, H. O. & Venter, J. C. (1999). Global trans- poson mutagenesis and a minimal Mycoplasma genome. Science 286, 2165–2169. REFERENCES King, K. W. & Dybvig, K. (1992). Nucleotide sequence of Mycoplasma Bergemann, A. D., Whitley, J. C. & Finch, L. R. (1989). Homology of Lartigue, C., Blanchard, A., Renaudin, J., Thiaucourt, F. & SirandPugnet, P. (2003). Host specificity of mollicutes oriC plas- mycoides subspecies mycoides plasmid pKMK1. Plasmid 28, 86–91. mycoplasma plasmid pADB201 and staphylococcal plasmid pE194. J Bacteriol 171, 593–595. Boehr, D. D., Daigle, D. M. & Wright, G. D. (2004). Domain-domain interactions in the aminoglycoside antibiotic resistance enzyme AAC(69)-APH(20). Biochemistry 43, 9846–9855. Byrne, M. E., Rouch, D. A. & Skurray, R. A. (1989). Nucleotide mids: functional analysis of replication origin. Nucleic Acids Res 31, 6610–6618. Lyon, B. R., May, J. W. & Skurray, R. A. (1984). Tn4001: a gentamicin and kanamycin resistance transposon in Staphylococcus aureus. Mol Gen Genet 193, 554–556. sequence analysis of IS256 from the Staphylococcus aureus gentamicintobramycin-kanamycin-resistance transposon Tn4001. Gene 81, 361– 367. Musatovova, O., Dhandayuthapani, S. & Baseman, J. B. (2003). Cao, J., Kapke, P. A. & Minion, F. C. (1994). Transformation of Peterson, S. N., Bailey, C. C., Jensen, J. S., Borre, M. B., King, E. S., Bott, K. F. & Hutchison, C. A., 3rd (1995). Characterization of Mycoplasma gallisepticum with Tn916, Tn4001, and integrative plasmid vectors. J Bacteriol 176, 4459–4462. Transcriptional starts for cytadherence-related operons of Mycoplasma genitalium. FEMS Microbiol Lett 229, 73–81. Cordova, C. M., Lartigue, C., Sirand-Pugnet, P., Renaudin, J., Cunha, R. A. & Blanchard, A. (2002). Identification of the origin of repetitive DNA in the Mycoplasma genitalium genome: possible role in the generation of antigenic variation. Proc Natl Acad Sci U S A 92, 11829–11833. replication of the Mycoplasma pulmonis chromosome and its use in oriC replicative plasmids. J Bacteriol 184, 5426–5435. Platt, M. W., Rottem, S., Milner, Y., Barile, M. F., Peterkofsky, A. & Reizer, J. (1988). Protein phosphorylation in Mycoplasma gallisepti- Culebras, E. & Martinez, J. L. (1999). Aminoglycoside resistance cum. Eur J Biochem 176, 61–67. mediated by the bifunctional enzyme 69-N-aminoglycoside acetyltransferase-20-O-aminoglycoside phosphotransferase. Front Biosci 4, D1–D8. Pollack, J. D., Williams, M. V. & McElhaney, R. N. (1997). The Daigle, D. M., McKay, G. A., Thompson, P. R. & Wright, G. D. (1999). Aminoglycoside antibiotic phosphotransferases are also serine protein kinases. Chem Biol 6, 11–18. Dhandayuthapani, S., Rasmussen, W. G. & Baseman, J. B. (1999). Disruption of gene mg218 of Mycoplasma genitalium through homologous recombination leads to an adherence-deficient phenotype. Proc Natl Acad Sci U S A 96, 5227–5232. Dhandayuthapani, S., Blaylock, M. W., Bebear, C. M., Rasmussen, W. G. & Baseman, J. B. (2001). Peptide methionine sulfoxide reduc- tase (MsrA) is a virulence determinant in Mycoplasma genitalium. J Bacteriol 183, 5645–5650. 526 comparative metabolism of the mollicutes (mycoplasmas): the utility for taxonomic classification and the relationship of putative gene annotation and phylogeny to enzymatic function in the smallest freeliving cells. Crit Rev Microbiol 23, 269–354. Pour-El, I., Adams, C. & Minion, F. C. (2002). Construction of mini-Tn4001tet and its use in Mycoplasma gallisepticum. Plasmid 47, 129–137. Reddy, S. P., Rasmussen, W. G. & Baseman, J. B. (1996). Isolation and characterization of transposon Tn4001-generated, cytadherencedeficient transformants of Mycoplasma pneumoniae and Mycoplasma genitalium. FEMS Immunol Med Microbiol 15, 199–211. Roberts, R. J. (2004). Identifying protein function – a call for com- munity action. PLoS Biol 2, E42. Downloaded from www.microbiologyresearch.org by IP: 54.196.252.114 On: Mon, 24 Oct 2016 02:37:34 Microbiology 152 Antibiotic resistance gene markers in M. genitalium Sabelnikov, A. G., Greenberg, B. & Lacks, S. A. (1995). An extended 210 promoter alone directs transcription of the DpnII operon of Streptococcus pneumoniae. J Mol Biol 250, 144–155. Sambrook, J. & Russell, D. W. (2001). Molecular Cloning: a Laboratory Manual, 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Sharples, G. J., Benson, F. E., Illing, G. T. & Lloyd, R. G. (1990). Molecular and functional analysis of the ruv region of Escherichia coli http://mic.sgmjournals.org K-12 reveals three genes involved in DNA repair and recombination. Mol Gen Genet 221, 219–226. Tully, J. G., Rose, D. L., Whitcomb, R. F. & Wenzel, R. P. (1979). Enhanced isolation of Mycoplasma pneumoniae from throat washings with a newly-modified culture medium. J Infect Dis 139, 478–482. Weiner, J., 3rd, Herrmann, R. & Browning, G. F. (2000). Transcription in Mycoplasma pneumoniae. Nucleic Acids Res 28, 4488–4496. Downloaded from www.microbiologyresearch.org by IP: 54.196.252.114 On: Mon, 24 Oct 2016 02:37:34 527